Prenataly Diagnosed Bilateral Congenital Cystic Adenoid Malformation, Class 2, a Case Report

Introduction

The term congenital lung malformation cover a wide range of disorders: congenital cystic adenomatoid malformation (CCAM), intra- and extra-lobar pulmonary sequestration (PS), bronchogenic cysts, congenital lobar emphysema and bronchial atresia. Theese malformations account for 5% of all congenital abnormalities, have a cumulative incidence of 30 cases per 100,000 individuals, and thus are considered rare disorders [1]. Congenital cystic adenomatoid malformations (CCAM) are developmental abnormalities of the lung. It was reported as a separate entity in 1949 by Chin and Tang. They are generally characterized as benign hamartomatous or dysplastic overgrowth of terminal bronchioles with a reduction in the number of alveoli. It results from abnormal maturation of the bronchopulmonary tree [2].

Incidence, Etiology and Classification

The incidence of CCAM is between 1:25,000 and 1:35,000 live births, with males in most series being more commonly affected [2]. The etiology of the entity remains unknown. Hamartomatous change in the terminal bronchioles or an arrest in their embryological development between 7 and 15 weeks of gestation is suspected. Decreased apoptosis also plays a role. The related genes in the pathogenesis are HOXB5, Fgf7, and PDGFB. Exaggerated signaling of the fibroblast growth factor 10 (FGF10) may be responsible for the formation of cystic-like structures during early lung development. FGF10 contributes to lung morphogenesis through its receptor FGFR2, and its signaling is down-regulated. There is increased expression of airway epithelial markers as well as dysregulated expression of genes related to the Ras and several kinases signaling pathways. Also mutations in the DICER1 gene leads to the formation of cystic airways, disruption of branching morphogenesis and mesenchymal expansion, features similar to pleuropulmonary blastoma. There is currently debate about the pathological classification of CTM [1]. Adzick et al. differentiated CCAM to macrocystic and microcystic types.

According to the 2002 Stocker classification, the term congenital pulmonary airway malformation (CPAM), can replace the former CCAM and includes five types:

1. Type 0 (bronchial type, formerly described as acinar dysplasia), bronchial-type airways separated only by abundant mesenchymal tissue.

2. Type 1 (the bronchial/bronchiolar type) and

3. Type 2 (the bronchiolar type) are characterized by cysts >2 cm in diameter and multiple small cysts, respectively.

4. Type 3 CPAM (the bronchiolar/alveolar type): the lesion is solid, and not cystic, because of the excess of bronchiolar structure separated by airspaces that resemble late fetal lung.

5. Type 4 CPAM (the peripheral type) is characterized by peripheral thin-walled, often multiloculated cysts.

CCAM is usually unilateral, mostly left-sided. The significance of bilateral lesions may relate to a genetic predisposition to an underlying cell signalling issue and perhaps increase the likelihood of a predisposition to subsequent malignant change within the CCAM or elsewhere in the lung. Rarely association with aneuploidy is found. Compression of the heart and the vena cava leading to mediastinal shift, polyhydramnios, and fetal hydrops may occur. Moreover, skeletal anomalies, Potter’s syndrome and gastrointestinal atresia may be additional findings [3].

Diagnosis, Differential Diagnosis

CCAM is usually identified during the anatomy ultrasound scanning of the second trimester. Prenatal diagnosis of CCAM has increased due to the advances in antenatal sonography. It can be used to assess size, location, characteristics (macro or microcystic, solid, or mixed lesions), and volume changes with growth, as well as blood supply, mediastinal shift, pleural effusion, or other signs of fetal hydrops. Moreover, the 3D sonographic evaluation allows all cystic lesions within the studied volume to be seen as opaque or echogenic. MRI is another useful tool for imaging CCAM in addition to ultrasound useful both to detect a systemic arterial blood supply and any complications. The differential diagnosis includes bronchopulmonary sequestration, bronchogenic cyst, neurenteric cysts, congenital lobar emphysema, and diaphragmatic hernia [2].

Poor Prognosis and Termination of Pregnancy

Poor prognostic findings are hydrops fetalis, ascites, polyhydramnios, bilateral lung involvement, and a lung-to-thorax transverse area ratio of less than 0.25. The cystic adenomatoid malformation volume ratio which is defined as the estimated volume of the lung lesion divided by head circumference is used to predict prognosis. A ratio >1.6, leads to a poorer prognosis (80% increased risk of fetal hydrops) [1,2]. The increase of the cardiomediastinal shift angle, a novel measure of mediastinal shift, has been significantly associated with an adverse perinatal outcome of CTM. Genetic counseling is necessary and pregnancy termination is an option in cases of poor prognosis. The peak CCAM growth is expected to occur by the 28th gestational week and then the cysts may decrease in size in 20% of the cases. Delivery should be planned in tertiary centres with a neonatal intensive care unit.

Prenatal Interventions

Conservative management, prenatally and postnatally, could be accepted in selected cases [4]. Fetuses with CCAMs and hydrops may be candidates for prenatal intervention where available: cystamniotic shunting, tumor resection before 32 weeks of gestation and percutaneous laser ablation.

Pediatric Surgery

Postnatal assessment is always recommended. Early neonatal surgery is required for symptomatic babies. Elective surgery is prefered in asymptomatic cases in 3–6 months of life to avoid respiratory infections, pneumothorax, or even malignancy. A partial lung resection using an axillary skin crease incision is proposed to obtain a good postoperative quality of life. Although rare entities, the most common relevant malignancies are bronchoalveolar cancer and rhabdomyosarcoma [5]. Usually, a lobectomy in such cases is performed, and then the mortality rates range from 9 to 49%.

Case Report

We present a case of 30 year old pregnant women (G2, para 1), refered to University gynecology and obstetrics clinic in 21 gestational week for 2nd trimester anomaly scan. Her medical and obstetric history were uneventfull. In the 10th gestational week of the current pregnancy she had a Covid 19 infection with mild symptoms. The ultrasound exam showed an adequate fetal growth for gestational age, placental morphology and amniotic fluid index. Fetal lung was markedly abnormal with hyperehogenic and cystic lesions mostly in the right lung pulmonary lobe with displacement of the heart and largest cyst with diameter of 10mm (Figure 1). Both partners were detally counceled and amniocentesis was performed. The quantitative analysis for trisomy 13, 18 and 21 was negative for numeric aberrations. MRI was performed: in the right pulmonary lobe in the hilar area there were 3 cystic changes around the blood vessels, in the parachylar area cyst with diameter of 7-8mm, anterobasal area one cyst with diameter of 10mm and smaller with diameter of 3mm. The findings suggested CCAM, type 2 (Figure 2). After genetic counseling parents decided for pregnancy termination, although they were informed regarding the prognosis and possible interventions.

Figure 1: Ultrasound images at the level of the fetal thorax.

Figure 2: MRI images of the fetus.

Pathohistological examination of the male fetus was in favour of the prenatal diagnosis. In the left pulmonary lobe and upper part of the right pulmonary lobe there were small cysts with a diameter of 0,3-0.6cm, lined with one layer of cubical epithelial cells (CK 7+), and thin fibromuscular layer (SMA+, desmin-). Between cystic changes there were parts of a fibrous tissue. The morphology was in favour of congenital cystic adenoid malformation of the lungs type 2.

Discussion

CCAM is a rare condition usually identified in the second trimester morphology scan. Because of the advances in antenatal sonography prenatal diagnosis of congenital fetal lung disorders has increased. Tran, et al. [5] after a retrospective study of 34 cases with CCAM proposed that asymptomatic neonates should have a postnatal CT even if the CCAM seems to have decreased on antenatal ultrasound. Computerised tomography seems better than X-ray in detecting lesions postnatally. Perinatal mortality of this anomaly can vary from 9% to 49%. In a retrospective study of Shamas, et al. [3] in 14 years period 26 cases were diagnosed around 20 weeks of gestation, all of them unilateral, 31% resolved, 8% decreased, 42% unchanged and 4% increased. Out of them: 16 cases required surgery, 4 were conservatively managed, 12% had associated anomalies. In a study by Mark Davenport, et al. [6] in a 6 years period 67 fetuses had a cystic lung malformation. They were diagnosed in the median age of 21 (19 to 28) gestational weeks, most of them left sided and microcystic, hydrops occured in 7%. Four antenatal interventions were performed: three thoraco-amniotic shunts and one percutaneous intrauterine laser therapy. There was one termination of pregnancy, 2 intrauterine deaths and 96% of the fetuses were born alive. Postnataly 63% had thoracotomy and excisional surgery at an average age of 7.5 months. Two infants (including the case of intrauterine laser therapy) died in the early postnatal period.

In a retrospective cohort study by Chen, et al. [4] in a period of 3 years out of 227 cases prenatally diagnosed as CCAM: 46 pregnancies were terminated, similar number of cases were microcystic and macrocystic. CCAMs presented more offen in male fetuses with polyhydramnios. Thirty one cases received successful surgical resection. In our case although the diagnosis was clear with ultrasound scan, according to most experiences fetal MRI was performed and diagnosis was confirmed. Although we didn’t expect a chromosomical aberration we did an amniocentesis for fetal cariotype. Parents were detally informed by a certified maternalfetal specialist and pediatric surgeons in terms of prognosis, possible outcome and postnatal surgical procedures. In this case CCAM volume ratio (estimated volume of the lung lesion/ head circumference) >1.6 leaded to a poorer prognosis so termination of pregnancy was an option according to the legal procedure in our country.

Conclusion

CCAM is a rare congenital anomaly with reported perinatal mortality as high as 49%. The prenatal and postnatal management remains controversial. Surgical management is the preferred option over conservative management postnatally. Genetic counseling is necessary and termination of pregnancy is an option in cases of poor prognosis [7].

For more Articles on: https://biomedres01.blogspot.com/

 

Virtual Rapid Sensing of Covid-19 Virus Antibodies in Patients Blood by Using Platinized Antigen Linking Graphene Probe

Introduction

In December 2019, a cluster of atypical pneumonia cases was detected in Wuhan, China, which soon spread throughout China before Chinese Lunar New Year in January 25, 2020. Outdoor movement restrictions were also adopted in a number of wide cities. However it was far too late. Here the novel coronavirus was named COVID-19 by the World Health Organization (WHO) on February 11, 2020. Later the COVID-19 epidemic was declared a public health emergency of international concern by WHO on January 30, 2020. Also later, on March 11, 2020 it was declared a pandemic by the WHO. On March 29, 2021, more than 126.89 million people have been confirmed to be infected (across over 223 countries, areas or territories), of which more than 2.78 million people died (WHO, 2020b) [1]. This is now pushing the whole of humanity into a biological warfare against viruses. Recent virus detection methods depend on the titrimetric PCR amplifications such as hemagglutination inhibition assay of the microneutralization [2], fluorescence spectrometric absorption method [3], photometric UV-Vis spectroscopy and electron microscopy [4] and others. Here conventional testing methods require approximately 1~8 days by virus culture, DNA amplification, electrophoresis separation and neutralization titration spectroscopic analysis. However, electrochemical in vivo or in vitro trace ion [5] and [6] cell [7,8] detection is fast, and only a few minutes are required. Diagnostic circuit fabrications are simple, so for this reason, we have developed modified probe sensing skills such as micro implementation [9] Diagnostic carcinoembryonic antigen tumor marker [10] detection, Pico molar ranges [11] working probe infrared photo diode electrodes [12,13] for in vivo cell [14] or human fluid [15] non treated tissue direct assay [16] and macro [17] synthesis [18] Human Blood Plasma [19] sensing ect, also which sensing circuit can be interfaced to telemetric WiFi wearable diagnostics for covid virus detection. Here developed results can replace the existing complex WHO method, such as PCR DNA amplification, Fluorescence Absorption Analysis, or chromatographic separation.

WHO Standard Diagnostic Protocol Comparison

Conventional WHO diagnostic protocols of PCR DNA amplication titrimetric methods is time consuming and replicated sophisticated skills are required. Also highly trained master’s and doctoral technicians are required: for example, Real-time RT-PCR assays for Eurasian H7HA standard protocols shown as follows

WHO Protocol 2

Real-time RT-PCR assays for Eurasian H7HA shown here.

Materials Required

1. QIAamp Viral RNA Mini Kit (QIAGEN®, Cat. No.52906) or equivalent extraction kit
2. ThermoFisher Fast Virus 1-step Master Mix (Applied Biosystems®, Cat. No. 44-2)
3. Ethanol (96–100%)
4. Microcentrifuge (adjustable, up to 13 000rpm)
5. Benchtop centrifuge with 96-well plate adaptor
6. Adjustable pipettes (10, 20, 100, 200μl).
7. Sterile, RNase-free pipette tips with aerosol barrier.
8. Vortexer
9. MicroAmp Fast Optical96-well reaction plate(Life Technologies, Part No.4346906)
10. MicroAmp optical adhesive film (Life Technologies, Part No. 4311971)
11. Real-time PCR system (ViiA™ 7 Real-Time PCR System)
12. Positive control (Available from HKU, e-mail: llmpoon@hkucc. hku.hk)
13. Primer and probe set.

Type/subtype

Influenza A (H7Nx). Gene:HA.

Name and Sequence

HA H7-1603F: TTTAGCTTCGGGGCATCATGTTT
H7-1674R: CAAATAGTGCACCGCATGTTTCCA
H7-1646P: FAM-TGGGCCTTGTCTTCATATGTGTAAA-MGB
Procedure from reference [20]
For more detailed examples of Covid 19 primers and probes sequences shown here. also which sequence was used to antigen N1~N3 mixing immobilized working probe fabrication. At this work. Here Table 1 shows the coronavirus disease 2019.molecular DNA sequence [21]. This DNA was used for the working probe mixed antigen immobiliz. The following images showing synthetic polyma in vitro film and sensing probe schimetic fabrication.

Materials and Methods Working Probe

(Figure 1A) A image is shown for skin tattoo coated conduction film made from synthesizing water-dispersion resin with the following characteristics: Softness, Wear-resistance, life extension, Skin protection, Conductivity and Transparency. Image B is a tattoo working electrode at the in vitro skin muscle electrode. Image C is voltammetric bio-electroanalyzer workstation with Wi-Fi telecommunications. It can be used to wearable diagnostic circuit for virus detection. Here in three electrode systems of counter and reference electrode was made like image B. However, working electrode fabrication is shown here, and the probe binder was used by synthesizing an aqueous dispersion resin. The resin paste was made with graphene nanopowder, and covid antigen, and platinum catalys were mixed with conductivity resin. Here the antibody antigen redox titration potential was obtained to reductions of -0.14V, 0.26V anodic scanning and - 0.9V oxidation peak currents was obtained during cathodic scanning. Analytical in vitro WiFi application is shown at (D).

Figure 1: (A) Skin tattoo micro rasin coating film.
(B) In vitro muscle skin tattoo working probe.
(C) Voltammetric Wi-Fi wearable coin size workstation.
(D) Virtual diagnostic in vitro schematic diagram of the working probe redox voltammetric ionic reaction for antigen immobilized on a graphene nanotube synthesize antibody antigen titration image.

Electrochemical Analyzer

Diagnostic circuit was used for the bioelectrochemical analyzer-2. voltammetric and our system, which can be designed to 5Cm×3Cm×60mm like physical coin size with telemetric WiFi control wearable workstation, potential windows of 2.0V~-2.0V redox potential windows, scanning. The current amplification of 1.0×10-3A~1.0×10-9A pico range and cyclic voltammetry redox, stripping voltammetry and chronoamperometry 2D visual control programs were used, power of USB interfaced ±2.5V strength was used.

Working Electrode Preparation

The diagnostic working probe was made by maxing a ratio of the graphene nano paste 2.0 g, mineral oil 0.5 g, Water-dispersible synthetic resin 0.5 g, platinum standard solution 1000 ppm 0.5 g. Paste was mixed completely during 20 minutes. The paste was coated on the graphite crystal load of 0.5 mm diameter 30 mm length, then connected to voltammetric working electrode terminal by using 0.35 mm pure copper enamel insulation coating wire, counter and reference electrode was made with the same method using graphite crystal load. The circuits are usable for wearable tattoo assay such as In-vivo or in vitro and feeling sensing analysis.

Results

Results and Discussion

Voltammetric analytical optimum para conditions were searched in PBS 5 mL electrolyte microtube conical rack, with 0.6 mL covid virus antigen spiking, at room temperature. The cyclic voltammetric antigen and antibody redox ionic voltammograms were searched.

Cyclic Voltammetric Optimization

Cyclic potential scanning is related to covid 19 virus ionic redox activation. For this purpose, the cyclic scan rate was searched from 0.2mv/sec~0.9mv/sec eight points in 0.9 mL antibody contained PBS buffer, 30 sec stirring convection with magnetic bar, only changed for scan rate variations. The real voltammogrms shown at Figure 2(A) is antigen antibody titration working image. (B) is, 0.2mv/sec scan rate oxidation peak obtained two site at -0.14V peak high of (4.322×10-5A) and 0.14V peak high of (3.46×10-5A) anodic current obtained then reduction peak of -0.9V peak high of (10.4×10-5A) cathodic obtained, which anodic and cathodic linear statistic 3rd equations shown there slope gradient, intercept and relative standard deviations, here in -0.14V potentials current linear increased, dx/dy=-31.782, y intersect is 3.4125, R2=0.8351 obtained. Other statistic equations not shown here. Figure (C) is reduction potentials of two peaks and oxidation of one linear equation obtained, least square linear equation and relative statistic results not shown in this figure, and the accumulation time increase. The sensitivity increase obtain, here qualitative potentials windows was used to square wave stripping voltammetry.

Discussion

Stripping Voltammetric Optimization

Cyclic voltammetric antigen and antibody anodic or cathodic ionization potentials were applied to sensitive stripping voltammetry. Here stripping accumulated amplifications are increasing to the detection limit, so anodic and cathodic scanning accumulation time variations were examined in 0.9 mL covid 19 antibody containing the PBS electrolyte. Stripping optimum amplified variations shown in Figure 3A, at the first point of 0.01 mV/Sec is 2.321×10-5A obtained in -0.2V potential windows anodic scanning, then continue variations performed during 10 steps by same methods, here final step is 0.05 mV/Sec 11.54×10-5A obtained on the linear curve. The least square linear equation is shown inserted in picture of Y=220.06x+0.9941, slop sensitivity is dx/ dy=220.06, intercept is 0.9941 and the relative standard deviation is R2=0.9164 obtained, at this para conditions square wave increments variation was examined from 0.001 mV/Sec to 0.006 mV/Sec with six steps, results shown in Figure 3B voltammograns and linear statistic equation, here in 0.004 mV/Sec is big current of 8.524×10-5A obtained, thus 0.05 V/Sec amplitude and 0.006 V/Sec increments are fixed. Under these conditions, diagnostic concentration effects were examined.

Figure 4 is analytical application effects for patients’ blood extracted antibody standard spike. The optimized final para conditions, diagnostic real antibody was examined in the PBS buffer electrolyte 8 mL volume. The first peak of electrolyte blank stripping is non signal appeared, then the 0.1 mL antibody spike was obtained to anodic of 0.7V oxidation current for 13.37×10-6A. In this figure, the inserted voltammograms shown slowly increased the sharp width, then continued spiking of 0.2, 0.3, 0.4, 0.5 and 0.6 mL the same conditions were added. Here the peak current 27.78×10-6A, 35.65×10-6A, 39.21×10-6A, linearly increased, then 31.92×10-6A, 25.37×10-6A decreased, which linear equations of dx/ dy=100.72, Y intercept is 3.054, the relative standard is R2=0.9504, which statistic results can be usable for real patients’ blood assay, anytime and anywhere immediately with self-detection. Thus, a more simplified tattoo wearable sensing circuit was fabricated, which can be used to telemetric remote control.

Figure 2: (A) Cyclic voltammetric scan rate variations for 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 mV/Sec, insert voltammograms shown reductions of -0.14V, 0.26V and -0.9V oxidation peak currents with 0.9 mL antigen spike in 3mL PBS electrolyte.
(B) Cyclic voltammetric accumulation time variations for 70, 80, 90, 100, 110, 120, 130, 140, 150 sec at (A) condition.
(C) Virtual real time voltammograms ionic imager.

Figure 3: (A) Square wave stripping amplitude variations for 0.01, 0.015, 0.02, 0.025, 0.03, 0.935, 0.04, 0.045, 0.05 V/Sec in PBS electrolyte 3mL, with 0.9mL Covid 19 antigen spike.
(B) Square wave increments potential variations for 0.001, 0.092, 0.03, 0.094, 0.005, 0.06 V/Sec of (A) electrolyte conditions.

Figure 4: Concentration effect of Covid-19 antibody for 0.1mL, 0.2mL, 0.3mL, 0 4mL, 0.5mL, 0.6mL standard spike, during stripping optimum para conditions, accumulation time was 60 sec string anodic -2.0V~-2.0V in PBS 8 mL buffer electrolyte.

Table 1: Covid 19, N1~N3 DNA sequence.

Conclusion

Diagnostic optimum results be attained in 60 seconds accumulation time only. During the anodic scanning, stripping peak potentials of 0.7V oxidation current was obtained of antibody antigen ionic transfer redox strength. Electrolyte buffer solution needed 5 mL PBS only and didn’t require any titrate or separation solutions. Detection systems used to Wi-Fi telemetric voltamnetric workstations of wearable patch type simple circuit of -2.0V ~ -2.0V potential scanning cyclic amplifier, working electrode is tattoo synthetic art painting film sensors of three electrode. The current range was 1.0×10-4A ~ 1.0×10-5A. The developed diagnostic results be used for virus detection and in any other field requiring human computer interfaced wearable tattoo bioassay and in vivo remote telemetric treatments.

For more Articles on: https://biomedres01.blogspot.com/

 

Bilateral Carotid-Cavernous Fistula: A Case Report and Literature

Case Report

We report a case of bilateral carotid-cavernous fistula CF) in a 72-year-old woman who presented with headache and double vision. After diagnosis and treatment in several hospitals, the patient came to our hospital an-accepted cerebral arteriography. It turned to be bilateral CCF and the patient recovered by interventional embolization. This case suggests that the possibility of CCF should be considered in patients with headache accompanied by diplopia. CCF is an abnormal communication between arteries and veins in the cavernous sinus, which can be divided into four types. Type A is the direct communication be-tween the main trunk of the internal carotid artery and the cavernous sinus; Type B is the communication be-tween the internal carotid artery branch and the cavernous sinus; Type C is the communication between the external carotid artery and the cavernous sinus through the Dural branch; Type D is the branch of the internal carotid artery and the external carotid artery communicating with the cavernous sinus at the same time [1]. According to pathology and treatment, CCF can be divided into direct type (type A), indirect type (type B, C or D), mixed type (including direct type and indirect type).

Due to the complex structure of the cavernous sinus, the clinical manifestations of CCF are not specific. As a result, patients with this disease may go to ophthalmology, neurology, otolaryngology, and neurosurgery. Misdiagnosing is likely to occur, which affects the timely diagnosis and treatment of patients. According to the characteristics of blood flow and hemdnamic disorders, CCF can be divided into the high-flow fistula and low-flow fistula, of which the direct type is mostly high-flow fistula, and the indirect type is mostly low-flow fistula [2]. Indirect CCF is usually unilateral, and bilateral is very rare [3-5]. We report a case of bilateral low-flow fistula with a long history of chronic progressive exacerbation. 6 months before admission, the patient developed left migraine headache without obvious inducement, which was a persistent dull pain, not serious, and she did not pay attention to it. She took analgesic by herself and relieved slightly. Four months before admission, the patient developed double vision with dizziness, accompanied by eyes pain, especially the left eye, and blurred vision of both eyes. The dizziness symptom improved after opening eyes. First she went to ophthalmology department of a certain hospital and ruled out ophthalmological diseases. Then she went to neurology department as advised. She took head magnetic resonance imaging, and it is normal.

Thus she was diagnosed as “diabetic oculomotor nerve injury”. She was given methylprednisolone and vitamin B. But there was no relief. A few days later, she went to the neurological clinic of another hospital. The doctor considered the possibility of painful ophthalmoplegia and recommended hospitalization. The patient was hospitalized for more than 20 days and was given intravenous hormone, neurotrophic drug, acupuncture and other treatments, but the symptoms were further aggravated, so she came to our hospital. She had diabetes for 3 months, lacunar infarction for 10 years, aortic valve replacement for more than 10 years, no history of infectious diseases, no food and drug allergy history, no positive family history and genetic history. On physical examination consciousness is normal, fluent in speech, the left eyeball is slightly protruding , bulbar conjunctiva hyperemia and edema, bilateral pupils are round but not equal, left: right=5.0:3.0mm, the right eye has direct and indirect light reflection, the left eye has weak direct and indirect light reflection, binocular vision decreased, diplopia, the left eye is relatively fixed, the addiction and abduction of the right eye are slightly restricted, no vascular murmur of periorbital auscultation, no eyeball pulsing, distribution area of the first branch of the left trigeminal nerve is hyperalgesia. Ophthalmic testing shows visual acuity is 20/40 OD and 20/133 OS, left eye lens cloudy, light color of optic disc, right eye lens turbidity, blurred fundus, intraocular pressure 14/15mmHg. Orbital CT scan shows bilateral eyeballs are protruding, bilateral medial rectus muscles are slightly thickened (Figure 1).

Figure 1: Orbital CT: bilateral eyeballs protruding and bilateral medial rectus muscles slightly thickened A and B.

Figure 2: Head MRI: no diffusion-limited signal is seen, long T2 signal of subcortical white matter can be seen on T2-weighted (A) and T2 flair imaging (B and C), and multiple localized vascular stenosis(D).

Head MRI scan: No diffusion-limited signal was seen, long T2 signal of subcortical white matter can be seen on T2-weighted imaging and T2 flair imaging, and multiple localized vascular stenosis (Figure 2). Head MRV: No obvious abnormalities (Figure 3). Related laboratory examination show: no obvious abnormalities in blood cell analysis, urinalysis, biochemical series, immune-related assay, and tumor series. Blood sugar is slightly higher, white blood cells can be seen in urinalysis. The preliminary clinical diagnosis cavernous sinus syndrome (reason to be determined) and diabetes. Because the patient did not improve according to the treatment of diabetic cranial nerve injury and painful ophthalmoplegia, and the patient did not have the common infectious factors of cavernous sinus thrombosis and the characteristics of acute onset and rapid progression, but showed a chronic progression combined with physical ex-amination of cavernous sinus injury and visual impairment. Although the patient did not have typical pulsating exophthalmos and arterial murmurs around the eyes, we still considered the possibility of cavernous sinus fistula and performed digital sub-traction angiography (DSA) after neurosurgery consultation.

Figure 3: Head MRV: No obvious abnormalities (A, B and C).

DSA showed bilateral cavernous sinus visualization and left ocular vein visualization in arterial phase, and the bilateral blood supplying arteries were both branches of the maxillary artery of external carotid artery (Figure 4). after the embolization, the arterial fistula disappeared under bilateral common carotid angiography (Figure 5). The postoperative reexamination head CT is shown in (Figure 6). Postoperative follow-up showed that the local swelling and protrusion of the eye completely disappeared on the 12th day after the operation, and the eye movement re-turned to normal on the 41st day after the operation, without diplopia. At present，4 months after the opera-tion, the patient still has a prominent visual impairment, her visual acuity is 6/10 OD and 20/50 OS, accompanying no other symptoms and sign (Figure 7). CCF is caused by the direct injection of arterial blood into the cavernous sinus after the carotid artery and its branches are ruptured. In terms of etiology, the direct type usually occurs in young people, usually caused by trauma (the most common), or medical reasons (such as surgical trauma), fibromuscular dysplasia, ruptured cavernous aneurysm, collagen deficiency and arterial dissection [3-6].

Figure 4: DSA shows: In the Arterial phase, both cavernous sinuses and left ocular veins can be seen. The blood-supplying arteries on both sides are the branch vessels of the maxillary artery, which is the branch of the external carotid artery.

Figure 5: Surgical procedure and postoperative angiography.

Figure 6: Reexamination of head CT after the operation.

Figure 7: The picture obtaining on the 41st day follow-up after the operation showed that the patient had no eye movement disorders and no diplopia.

The C-type arteriovenous fistulas are more common in postmenopausal women. Most of the fistulas are spontaneous, some can resolve spontaneously, but some patients have a slow progressive aggravation just as we reported here. It is related to cavernous sinus thrombosis, pregnancy, sinusitis, trauma, atherosclerosis, connective tissue disease, hypertension, and diabetes [7-9]. The internal carotid artery passes through the cavernous sinus, also the oculomotor nerve, trochlear nerve, abducens nerve and the ocular branch of trigeminal nerve. Therefore, clinical symptoms such as exophthalmos, diplopia, eye pain, blurred vision, increased intraocular pressure, pulsating tinnitus, headache and ophthalmoplegia often appear after injury [3,4,8-10]. High-flow fistulas can even have orbital murmurs, pulsatile eyeballs, conjunctival edema, ocular surface congestion, vascular distortion (conjunctival spiral blood vessels), dilated and tortuous fundus blood vessels. Compared with direct CCF, indirect CCF is more insidious with milder symptoms and signs. Due to a series of ocular symptoms, many patients are often go to the ophthalmology department firstly. As CCF is mainly manifested by cavernous sinus syndrome and progressive vision loss, it should be identified with orbital apex syndrome, intraorbital congestion, orbital inflammatory pseudotumor, congenital orbital plate defects, endocrine diseases, cavernous sinus tumor com-pression, Tolosa-Hunt syndrome, jugular vein tumors, intraorbital and skull base arteriovenous malformations [11,12].

In terms of diagnostic criteria and auxiliary examinations, because of the diverse clinical manifestations of carotid-cavernous fistula and the low detection rate of CTA/MRV, DSA is the gold standard for CCF diagnosis. It has been reported in the literature that when the difference of the ocular pulse amplitude (OPA) measured by the tonometer exceeds 1.6mmHg, the sensitivity to screen unilateral CCF reaches 100% and the specificity reaches 93%. There is no difference between direct type and the indirect type [13]. Orbital ultrasound can usually show dilated superior ocular veins and orbital hyperemia, thickening of extraocular muscles, etc. It can also be used as a basis for differential diagnosis, such as orbital tumors, thyroid dysfunction, orbital disease, orbital inflammation, scleritis, myositis or endocrine Myopathy [14]. In terms of treatment, most of the indirect CCF are low-flow fistulas. The fistulas may close spontaneously and often do not require invasive treatment. Observation is the main focus. However, if there is an uncontrollable increase in intraocular pressure, persistent ophthalmoplegia and diplopia, severe exophthalmos with corneal expo-sure, optic neuropathy, retinal ischemia, severe murmur on auscultation, and angiography or SWI showing cortical venous fistula drainage, early intervention and treatment should be required [10]. Transvenous endovascular embolization is the preferred treatment for indirect carotid-cavernous fistulas. If the access via the femoral vein is restricted, the direct orbital approach can be selected [15], but the former method is safer and more effective. When the intravascular approach is not feasible or unsuccessful, stereotactic radiosurgery (SRS) can be considered for CCF.

In summary, the symptoms of indirect low-flow cavernous fistula are mild at onset, and the clinical symptoms are not typical, such as dizziness, headache, eye pain, conjunctival congestion and edema, mild eye movement limitation, and often within the normal range of intraocular pressure. There is no abnormality in head MRI, and it is easy to be missed and misdiagnosed clinically. Some lowflow fistulas can close spontaneously, and the clinical symptoms are naturally relieved, while some low-flow fistulas progress slowly, and the symptoms and signs gradually become prominent. When the patient has a headache, eye pain, exophthalmos, and conjunctival congestion and edema, the cranial nerve palsy of the first branch of the third, fourth, Ⅴ, and Ⅵ groups, ac-companied by decreased vision, even if there is no typical pulsating exophthalmos and eye circumference For murmurs, the possibility of CCF should also be considered, and active surgical treatment should be carried out to relieve symptoms as soon as possible to prevent sequelae optic nerve damage.

For more Articles on: https://biomedres01.blogspot.com/