Thursday, July 31, 2025

Determining Grip Width for Proposed Shoulder Saver Bench Bar

 

Determining Grip Width for Proposed Shoulder Saver Bench Bar

Introduction

The bench press is a popular upper body exercise commonly used to develop both size and strength in the chest, shoulders, and triceps musculature. Most injuries pertaining to the bench press occur either abruptly from high force movements or gradually from repeated low force movements (Asaa, et al. [1,2]). Additionally, most bench press related injuries occur at the shoulder (Golshani, et al. [3-5]). (Escalante [6]) suggests that shoulder is most prone to injury when abducted and externally rotated, both of which occur when performing the bench press. Individuals with shoulder injuries are often precluded from performing the bench press or require some type of exercise modification. For example, (Green, et al. [7]) recommend individuals with shoulder injuries perform the bench press with a narrower grip and stop the descent of the bar 4-6 centimeters (cm) above the chest. Other recommendations for individuals with shoulder injuries include performing the bench press with dumbbells or using a multi-grip bar instead of the traditional straight bar.

Another possible option for individuals with shoulder injuries could be the Shoulder Saver Bench Bar (Figure 1), a hypothetical new barbell that allows users to employ similar a hand placement to that of the dumbbell bench press without the bulkiness of a traditional multi-grip bar (Figure 2). The purpose of this study was threefold. First, to determine the average (i.e., mean) biacromial width and distance between the third and fourth phalanges of both hands taken at the metacarpophalangeal joint when in a push-up position (hereafter referred to as hand measurement) for the test subjects participating in the study. Second, to determine whether a “one size fits all” option would be possible for the proposed Shoulder Saver Bench Bar, and if so, what the distance between the hand grips should be to accommodate most users. Third, if a “one size fits all” option is not possible, to determine how many size options there should be for the proposed Shoulder Saver Bench Bar to accommodate most users as well as what the distance between the hand grips should be for each size option.

biomedres-openaccess-journal-bjstr

Figure 1: Proposed Shoulder Saver Bench Bar.

biomedres-openaccess-journal-bjstr

Figure 2:
a) Hand placement for traditional straight bar.
b) Hand placement for dumbbell bench press.
c) Hand placement for multi-grip bar.

Methods

Test subjects from the study included faculty, staff, and students from Cedarville University who were 18 years or older and able to perform at least one push-up. The following demographic information was taken from each test subject: height, weight, biacromial width, and hand measurement. Although the researchers are unaware of any previous studies that used hand measurement as an official means of measurement, several studies have used biacromial width when assessing upper body strength and pushup performance (Cogley, et al. [8-10]). Data on all test subjects was collected via two stations. At the first station, height and weight measurements were taken. Both measurements were taken using health-o-meter professional scale (Model No. 500KL). At the second station, biacromial width and hand measurement were taken. Both measurements were taken using a Sammons Preston Rolyan tape measure. Data was recorded in Excel spreadsheet and converted to SPSS. Analysis included measures of central tendency, correlations between interval level variables, and an investigation of mean differences between meaningful categories. Multivariate analysis was conducted but revealed nothing significant beyond the bivariate results reported below.

Results

The variables analyzed were gender, height (in inches (in.)), weight (in pounds (lbs.)), biacromial width (in cm), and hand measurement (in cm). Hand measurement was the dependent variable. A total of 52 test subjects participated in the study, 31 were male and 21 were female. Descriptive statistics of the interval level variables, to include the mean, range, and standard deviation of the various variables, are provided in (Table 1). As depicted by the reported range and standard deviation in (Table 1), there was a significant amount of variability for hand measurement. Specifically, while the mean for the hand measurement was just over 56 cm, cases varied from 39 cm to 74 cm. Given that hand measurement was the variable of interest, the remainder of the statistical analysis was used to determine how the remaining variables related to hand measurement. (Table 2) reports correlations among the interval level variables. Unsurprisingly, there were significant relationships between height, weight, and biacromial width. However, only weight was correlated with hand measurement. Although the relationship between weight and hand measurement was statistically significant and positive, it was moderate in nature (i.e., r = .343). Additional analyses were performed to determine if differences in hand measurements could be found based on nominal categories such as gender and weight. Results of these analyses are provided in (Table 3). In terms of gender, the results indicate there were no significant differences in mean hand measurement for males (56.90 cm) and females (55.57 cm). In terms of weight, the results indicate there was a significant difference for weight when reconstructed categorically. Specifically, the mean level of weight was effectively 165 lbs., so a variable that considered cases at or under 165 lbs. (n = 26) in comparison to those over 165 lbs. (n = 26) was constructed. The results showed a significant difference for those test subjects weighing at or under 165 lbs. (53.96 cm) as compared to those weighing over 165 lbs. (58.77 cm).

biomedres-openaccess-journal-bjstr

Table 1: Descriptive Statistics.

Note: N = 52

biomedres-openaccess-journal-bjstr

Table 2: Correlation Matrix.

Note: *Correlation is significant at the .05 level (2-tailed)
**Correlation is significant at the .01 level (2-tailed)
N = 52

biomedres-openaccess-journal-bjstr

Table 3: Mean Differences in Hand Measurement by Gender and Weight.

Note: *Significant at the .05 level (two-tailed)
N = 52

Limitations

The primary limitation of the study was the small sampling size (n = 52). It is possible that additional cases, with a stronger sampling of females, additional body types (as defined by height and weight in isolation and in combination), or age ranges could yield different results.

Discussion

The results of the study suggest that hand measurement is not statistically related to gender, height, or biacromial width, but is moderately correlated to weight when measured continuously or nominally. The results of the study also suggest that a “one size fits all” option for the proposed Shoulder Saver Bench Bar may be possible and that the proposed distance between the hand grips should be 22 in. (56 cm). If the proposed Shoulder Saver Bench Bar were to be offered in multiple size options, the results suggest that having two size options would accommodate most users. Specifically, 21 in. (53.96 cm) between the hand grips for smaller users (i.e., at or under 165 lbs.) and 23 in. (58.77 cm) between the hand grips for larger users (over 165 lbs.).


For more Articles on: https://biomedres01.blogspot.com/

Wednesday, July 30, 2025

Evaluation of Role of Pineapple in the Duration of Labour

 

Evaluation of Role of Pineapple in the Duration of Labour

Introduction

Labour is the last few hours of human pregnancy. Overall, it does not last for more than 24hours [1]. It is characterised by forceful & painful uterine contractions that effect cervical dilation & cause the fetus to descend through the birth canal. Extensive preparations take place in both the uterus and cervix long before this. Labour onset clearly represents the culmination of a series of biochemical changes in the uterus and cervix. These result from endocrine and paracrine signals emanating from both mother and fetus. Physiological and psychological changes can have an impact on labour. The muscles around the pelvis are tense, there is pain, the body is weak and tired, so the mother loses the power to push. Hence, the loss of strength to straining can cause parturition to last longer [2]. One of the efforts taken to improve contractions in labour is to use oxytocin as a pharmacological effort. However, nonpharmacological effort is more recommended as a natural alternative to help the contractions remain stable. In this study the supply of food to help labor is to consume fruit that contains substances to ease uterine contractions such as pineapple [3]. Pineapple contains high Vitamin C, sugar, minerals, serotonin and bromealin enzymes [4]. In 100grams of Pineapple fruit contain variety of nutritional elements which can stabilize uterine contractions, ease the labour and meet the nutritional needs of mothers. By consuming 100grams of Pineapple the time of latent phase of Stage 1 is expected to help mothers deliver the baby smoothly and the condition of the mother and baby are in good health.

Materials and Methods

A quantitative study was done. The population was mothers in latent phase of stage one. The sample was 76 respondents which consist of 27 respondents who had pineapples (100 g) and 22 control respondents who did not have any fruit or drug. They were taken from Dr D.Y. Patil Medical College in compliance with the inclusion and exclusion criteria.

Inclusion Criteria

1) Age group > 18 years

2) Term pregnant women

3) No co-morbidities.

Exclusion Criteria

1) Preterm

2) Gestational Diabetes Mellitus and other co-morbidities

3) Contracted Pelvis.

Data Analysis

The Characteristics of Respondents (Table 1)

biomedres-openaccess-journal-bjstr

Table 1.

Interpretation: Based on above table, the characteristic of respondents is:

a) Age: In the pineapple group, from 42 respondents, there were 38 respondents (90.40%) mostly who are 18-35 years old, there were 4 respondents (9.5%) who are >35 years old.

b) Occupation: In the pineapple group, from 42 respondents, 28 (66.6%) were homemakers, meanwhile in the control group from 46 respondents, 30 (65.2%) did not work.

c) Hb: In the pineapple group, from 42 respondents there were 34 (80.9%) respondents had mostly normal Hb while in in the control group of from 46 respondents, 6 (13.04%) were anemic.

d) Parity: In the pineapple group, from 42 respondents, there were 22 respondents (52.3%), whom are mostly primipara, in the control group from 46 respondents, there were 22 respondents (47.8%) whom are mostly primipara.

The Difference in Time Duration in Labour Between Study and Control Group

Stage I: (Duration of labour in Pineapple group – Duration of labour in Control group) = 704.624 min.

Stage II: (Duration of labour in Pineapple group – Duration of labour in Control group) = 28.421 min.

Based on the results of Table 1, the length of stage I of the intervention of pineapple consumed showed P value 0.012 <α 0.05. Meanwhile, the length of the stage II the intervention of pineapple consumed showed P value 0.029 <α 0,05

Discussion

The Characteristic and Normality of Respondents

Based on the results of statistical tests on the characteristics of research subjects, it showed that there were no significant differences in the characteristics of respondents based on age and work among two groups. However, there are differences in the characteristics of respondents based on Hb and parity between the two groups. Therefore, it can be concluded that the characteristics of respondents based on Hb, and parity affect the results of the intervention in the two groups. Low Hb levels in pregnant women until the time of the labor process affect the work of the reproductive muscles, namely the uterine muscles, pelvic muscles and ligaments. This results in the mother not to have the power to push which influence on the opening of the birth canal and finally the labor process has difficulty [5]. Abnormalities of power (contraction) are found in primigravida, especially old primigravidas. In multiparas, there are more abnormalities of uterine inertia. Abnormal contraction both strength and nature, will inhibit labor.

Length of Stage I and Stage II in Study Group which Consumed Pineapple Compared to Control Group

The study showed that Pineapple can reduce the length of stage I of labour by about 704.624 minutes and of stage II by 28.421 minutes. Pineapple eases the uterine contractions in labour and has antioxidants and anti-microbial effects due to presence of Vitamin C. It also contains other minerals and enzymes such as Bromelain which stimulate prostaglandin production. This prostaglandin is one the factors which causes uterine contraction in labour [4]. Trials on animals (female guinea pigs) prove pineapple fruit extract causes uterine contractions [6]. Based on international journal of Ethnopharmacology in Uganda it states that Pineapple is one of the fruits that can induce labour due to enzyme bromelain [7]. This research is supported by another research conducted in West Sumatra according to which consumption of 100 grams of Pineapple to a mother of 36 weeks of gestation affects uterine contractions [8].

Conclusion

Length of stage 1 of labor is shorter in mothers who consume 100 g of pineapple compared to control group.

Length of stage 2 of labor is shorter in consuming the pineapple compared to control group but not clinically relevant.


For more Articles on: https://biomedres01.blogspot.com/

Tuesday, July 29, 2025

A Neuropsychopharmacological Approach to an IBGC Case

 

A Neuropsychopharmacological Approach to an IBGC Case

Introducing the Clinical Case

The Idiopatic Basal Ganglia Calcification (IBGC), or Fahr’s disease, is a rare disease with less than 200 reported cases. It presents an autosomal dominant inheritance pattern and is clinically characterized by the psychiatric disorders, neurological disorders and abnormal movements triad. This clinical case’s purpose is to highlight the importance of communication and multidisciplinary therapeutic choices between psychiatrist and neurologist. A 56-year-old man presents with a panel of acute atypical psychosis that combines delirious ideas of persecution, of intuitive and interpretative mechanism, systematized in networks, with complete adherence to the delirium and anxiodepressive repercussions in a context of auditory hallucinations. This psychiatric panel is associated at different moments in the disease with paraesthesia, haloaesthesia, balance and walking issues combined with an unstable gait, dysarthria, vertigo, postural tremors and static disorders and extrapyramidal syndrome with major akinesia. Clinical and paraclinical exams make a diagnosis of IBGC with mutation of the SLCA20A2 gene Figure 1. Treatment by QUETIAPINE (800mg/day) enables the complete abrasion of the psychotic symptomatology and the combination of benzodiazepines and ALIMEMAZINE reduces anxiety and sleep disorders. Combining QUETIAPINE with benzodiazepines is necessary, initially, to control anxious displays caused by the diagnostic announcement and the knowledge of associated neurologic disorders. LEVODOPA proves to be ineffective, and ROTIGOTINE causes chorea after 6 weeks of treatment, which doesn’t allow finding a fitting treatment that limits abnormal movements and correlated anxiety. Multidisciplinary support combining ergotherapy, physiotherapy, speech therapy and physical exercise in a therapeutic group is initiated when the treatment begins.

biomedres-openaccess-journal-bjstr

Figure 1: Cerebral scanner without injection in axial section in parenchymatous window. Spontaneous hyperdensity of the internal pallidus globus, the thalamus and the pineal gland corresponding to the calcifications.

Therapeutic Discussion

Fernandez et al have demonstrated that the use of QUETIAPINE in patients suffering from Parkinson’s disease or dementia with Lewy bodies enabled a partial or even complete abrasion of the psychotic symptoms, and with only small dosages (50mg/day). It has also been demonstrated that the continuing use of QUETIAPINE in the long run was compromised in numerous patients because of the deterioration or the outbreak of motor disorders [1]. As our patient was stabilized on 800mg/day of QUETIAPINE and because of motor disorders (especially extrapyramidal syndrome) and their anxio-depressive repercussions, we saw fit to look for an alternative. CLOZAPINE has had a marketing authorization since 2001 for the treatment of psychotic disorders in Parkinson’s disease. The evaluation file has demonstrated that a disappearance of psychotic symptoms happens in 40% of patients, without aggravating the motor symptoms [2]. It has also been established that the necessary dosage of CLOZAPINE is largely inferior to the usual posology for schizophrenia (up to 800 mg/day). Indeed, the average dosage is under 125mg/day and barely ever goes over 250 mg, without increasing the extrapyramidal symptoms in more than 90% of the cases [3]. Given these indications, the treatment by QUETIAPINE was stopped and switched to CLOZAPINE, whose lowest efficient dosage was 62.5mg/day for our patient.

During the patient’s treatment, some neurologic signs appeared (gait disorders, sedation, dizziness) that were linked to Fahr’s disease but could also be related to or potentiated by the benzodiazepines (LORMETAZEPAM/ZOPICLONE) or “hidden” neuroleptics (ALIMEMAZINE) [4]. However, CLOZAPINE produces a sedative effect because of its H1 antagonist, anticholinergic and alpha-1 adrenergic antagonist action. CLOZAPINE, much like HYDROXYZINE, has an H1 antagonist component with anxiolytic features [4]. Therefore, it has been decided to ban the use of benzodiazepines and “hidden” neuroleptics and to use higher dosage of CLOZAPINE associated with HYDROXYZINE in the lowest efficient dosage. The major benefits of a treatment by physiotherapy, speech therapy, physical exercise and also psychotherapy on motor symptoms in Parkinson’s disease have been established in numerous studies [5]. Motor disorders being a strong source of anxiety in our patient, an ergotherapeutic, psychotherapeutic and re-educational treatment enabled a significant improvement on the psychological side. Moreover, we were able to observe an improvement in the memory disorders, especially through the measurement of the MMS (18/30 initially; 25/30 2 years later), and also a stabilization of the motor disorders measured by the SARA and UPDRS III score (initially, SARA: 12.5/40, UPDRS: 32/108; 2 years later, SARA: 8/40, UPDRS: 14/108). We can ascribe these results to the multidisciplinary treatment.

Conclusion

The neuropsychiatric and therapeutic choices and reflexion were capital for this patient. They enabled stabilization and even an improvement of psychiatric symptoms and even of some neurologic symptoms. Considering neurologic signs as elements of the diagnostic but also as factors of aggravation in psychiatric disorders (anxio-depressive) was therefore important. The integrated multidisciplinary treatment was thus the key to the positive clinical evolution of our patient.


For more Articles on: https://biomedres01.blogspot.com/

Friday, July 25, 2025

A Study on the Survivability of Bifidobacteria Contained in Acid-Resistant Formulations Under Acidic Environment

 

A Study on the Survivability of Bifidobacteria Contained in Acid-Resistant Formulations Under Acidic Environment

Introduction

Over 100 trillion bacteria of more than 1,000 types live in the human intestine, forming the intestinal flora. Lactic acid bacteria and bifidobacteria-typically considered beneficial-lower the pH in the intestine by producing lactic acid and acetic acid, and suppress the growth of harmful bacteria and the production of putrefactive products. As a result, it has been reported to contribute to the prevention of illness and the maintenance of health [1,2]. Live bacteria that work beneficially to the host animal by improving the balance of intestinal bacteria are called “probiotics” and are used in various foods [3-5]. Bifidobacterium, a type of probiotic, is reported to exert various beneficial effects on the body through oral ingestion [6-9]; its main growth site is the large intestine. Orally ingested bifidobacteria are required to reach the intestines alive because it is important for live probiotics to act in the intestines. However, bifidobacteria are sensitive to acid, so when taken orally, they are affected by gastric acid. Therefore, there is concern that the viable cell count may decrease significantly when it reaches the lower part of the intestinal tract or growth site. Thus, when using bifidobacteria as probiotics, it is important to consider the acid resistance of the formulations. Although acid-resistant capsules are generally used to impart acid resistance to the formulation, it may be advantageous avoid using acid-resistant capsules when considering the leachability of other active ingredients. Therefore, we developed an acid-resistant formulation that contains both bifidobacteria and other active ingredients, without the use of acidresistant capsules. This study applied two methodologies in the form of nonclinical and clinical investigations to examine the acid resistance and bacterial survivability of this formulation.

Materials and Methods

Formulation

For the nonclinical investigation, we used two types of formulations; namely, a bifidobacteria-containing acid-resistant formulation (acid-resistant formulation) and bifidobacteriacontaining nonacid-resistant formulation (nonacid-resistant formulation). Hydroxypropyl methylcellulose (HPMC) and milk protein hydrolysates were used for the acid-resistant formulation, and crystalline cellulose was added instead for the nonacidresistant formulation. Bifidobacterium breve B-3(B-3; Morinaga Milk Industry Co., Ltd., Tokyo, Japan) and Bifidobacterium longum BB536 (BB536; Morinaga Milk Industry Co., Ltd.) live bacterial powder were used as probiotics; all other ingredients and quantities were the same. For the clinical study, a commercially available acidresistant formulation containing B-3 and BB536 (Naishi Support; FANCL Corporation, Kanagawa, Japan) was used as the test food. The number of viable bacteria contained in the daily test food was 5 billion for B-3 and 10 billion for BB536. The capsule used was a nonacid-resistant hard capsule (Vcaps PLUS; Capsugel, New Jersey, United States) containing HPMC as the main component.

Nonclinical Study

A disintegration test was conducted in accordance with the 17th edition of the Japanese Pharmacopeia [10]. A disintegration tester (NT-40HS; Toyama Sangyo Co., Ltd., Toyama, Japan) was used to measure the time taken for the formulations to disintegrate in solution 1 (pH 1.2) and solution 2 (pH 6.8) of the Japanese Pharmacopoeia at 37°C. The auxiliary board was not used. The judgment of disintegration was not when the outer capsule was dissolved, but when the mass of contents was dispersed in pieces; disintegration was observed up to 180 min. Capsules treated with solution 1 for 120 minutes were suspended in saline, mixed with TOS propionate agar medium (TOSP medium; Yakult Pharmaceutical Industry Co., Ltd., Tokyo, Japan), and cultured at 37°C for 72 hours under anaerobic conditions (AnaeroPack Kenki, Mitsubishi Gas Chemical Company, Inc., Tokyo, Japan). After culturing, the colony count was measured.

Clinical Study

Prior to its implementation, the clinical study was reviewed and approved by the Kobuna Orthopedic Clinic Ethics Committee (Tokyo, Japan, date of approval: March 4, 2021). The study was conducted in accordance with the Declaration of Helsinki (adopted in 1964, revised to its 7th Amendment at the WMA General Assembly of 2013 in Fortaleza) and the Ethical Guidelines for Medical and Health Research Involving Human Subjects (adopted December 22, 2014 and partially revised on February 28, 2017) to protect the human rights of subjects, and under the supervision of a physician. Participants were informed regarding the purpose and details of the study, providing voluntary, written consent for participation. This study was registered in the UMIN Clinical Trials Registry (UMIN 000043672).

Study Subjects

The subjects were healthy males and females aged 20–64 years who were capable of normal defecation on a daily basis. The exclusion criteria were follows: diarrhea or constipation; user of antibiotics; user of drugs that may affect digestion and absorption; being unable suspend the use of drugs, quasi-drugs, and health foods (foods containing B-3 and BB536) that may affect the study outcomes; food allergies; heavy drinking; diseases or serious complications requiring urgent treatment; gastrointestinal diseases or history of surgery that may affect digestion and absorption or defecation; irritable bowel syndrome; pregnancy or lactation; addiction to drugs and/or alcohol; participation or intent to participate in another clinical study; and being deemed ineligible for participation at the discretion of the principal investigator. The work associated with the management of subject recruitment was outsourced to the contract research organization KSO Co., Ltd. (Tokyo, Japan).

Study Method

The study was a single-group before-and-after study design; 10 subjects, selected at the discretion of the physician among 30 consenting candidates based on the background information obtained, were enrolled in the study. The intervention period was 2 weeks and subjects took 3 capsules daily after dinner. During the study (from provision of consent to the end of final tests), subjects were prohibited from consuming foods containing B-3 and BB536, as well as all health foods. For a total of 4 weeks-including the 2 weeks of pre-observation and 2 weeks of intake-subjects were asked to maintain their lifestyle habits. They were prohibited from consuming large amounts of alcohol (20 g/day of pure alcohol) and instructed to avoid using drugs—such as intestinal regulators and laxatives-that may affect bowel movements. They were also prohibited from drinking alcohol the day before and on the day of testing, as well as from smoking on the day of testing.

Survey and Test Items

As part of the background investigation, we collected data regarding sex, age, BMI, defecation status, health condition, use of drugs, use of supplements, details of diet, consumption of alcohol, and presence of food allergies. Additionally, subjects were asked to a keep daily record of whether or not they ingested the test food, changes in physical conditions, lifestyle changes, use of drugs and medicines, and the details of their diet and meals (including alcohol consumption) during the pre-observation and intervention periods. Subjects provided fecal samples both before and after the intervention period; these were used to determine the presence or absence of viable B-3 and BB536 in feces, as well as to measure the bacterial count. Subjects placed the feces in a sealable container and submit it to the testing facility (Kyoto Institute of Nutrition & Pathology, Inc., Kyoto, Japan) within 24 h after defecation, in cold storage and under anaerobic conditions.

Confirming the Presence or Absence of Live Bacteria

The presence or absence of live B-3 and BB536 in fecal samples was determined using a combination of the plate smear culture method and real-time quantitative polymerase chain reaction (RT-qPCR; culture-PCR method). After determining the total fecal weight, 1.0 g of homogenized feces was diluted stepwise in an anaerobic sample diluent (composition per 1L: 3.0 g Na2CO3, 0.9 g NaCl, 0.45 g K2HPO4, 0.45 g KH2PO4, 0.9 g (NH4)2SO4, 0.19 g MgSO4 ・7H2O, 0.12 g CaCl2・2H2O, 0.5 g L-Cysteine・HCl・H2O, 0.001 g resazurin, 0.5 g Agar, 50 μL Antifoam emulsion); 100 μL of the 10-5 diluted fecal solution was smeared onto TOSP medium and subjected to static culture for 48 hours at 37℃ under anaerobic conditions. After the culture period, the colony was recovered using a scraper and suspended in saline; 20 μL of the suspension was used for DNA extraction and RT-qPCR.

Bacterial Count Measurement

The total bacterial count (the total number of live and dead bacteria) of B-3 and BB536 in feces was measured according to the following procedures: 900 μL of phosphate buffered saline (PBS) was added to 100 mg of homogenized feces and thoroughly suspended until there were no more lumps (hereinafter, fecal suspension). To 200 μL of the fecal suspension, 800 μL of PBS was added before stirring and centrifuging the mixture (13,000×g, 5 min, 4°C); DNA was extracted from the remaining residue (equivalent to 20 mg of feces) after removing 800 μL of the supernatant, and was subsequently used for RT-qPCR. Next, we attempted to detect and quantify live bacteria in feces using propidium monoazide (PMA), an intercalating agent that binds to DNA (hereinafter, PMA-qPCR method). PMA, a selective membrane-permeable dye, invades the double-stranded DNA of dead cells with broken membrane integrity, binds to DNA by light irradiation, and inhibits the PCR reaction. Therefore, PMA treatment inhibits the PCR amplification of dead cells, enabling the specific quantification of viable cells [11]. To 200 μL of the previously obtained fecal suspension, 1 μL of PMAXX TM (20mM, BTI; Biotium, Inc., California, United States) was added. A suspension was produced by pipetting, stirred using a vortex as appropriate, and left to stand for 10 min at room temperature. The suspension was subsequently irradiated for 10 min with an LED Crosslinker12 (Takara Bio Inc., Shiga, Japan) and centrifuged (13,000×g, 5 min, 4°C), after which DNA was extracted from the remaining residue (equivalent to 20 mg of feces) after removing the supernatant; the extracted DNA was subsequently used for RT-qPCR.

DNA Extraction and RT-qPCR

DNA was extracted from samples using the QuickGene-810 system (Kurabo Industries Ltd., Osaka, Japan) and QuickGene DNA tissue kit (Kurabo Industries Ltd.) following previously reported procedures [12]. In particular, 250 μL of tissue lysis buffer (MDT) was added to a conical tube packed with beads containing the sample; the crushing process was performed twice at 3,000 rpm for 2 min using the Micro-Smash MS-100 (TOMY SEIKO Co., Ltd., Tokyo, Japan), producing a crushed solution. To this crushed solution, 25 μL of Proteinase K (EDT) was added, mixed, and left to stand for 2 h in a 55°C dry bath. The solution was then centrifuged (15,000×g, 10 min, room temperature), and 180 μL of lysis buffer (LDT) was added to 200 μL of the supernatant and mixed; the mixture was then left to stand for 10 min in a 70°C dry bath. After standing, 240 μL of 99.5% EtOH was added to the mixture, stirred well, and centrifuged (8,000×g, 1 min, room temperature), before purifying the supernatant using the QuickGene-810 system and its accompanying filter. After purification, the DNA extract was eluted with an elution buffer (CDT) and stored at -20℃ until use.

RT-qPCR was performed using the extracted DNA as a template, as well as B-3-specific primer (forward, GCGATACTGCCAGAACACCT; reverse, CACTATCAACGGCAGATTTCG) and BB536-specific primer (forward, GAACAGGGTGTGCTGAGTGA; reverse, CAAGCGAGAAGATCATCGAA) [13,14]. TB Green® Premix Ex Taq™ (Tli RNase H Plus; Takara Bio Inc.) was used to perform RT-qPCR. The reaction mixture comprised 5 μL of TB Green® Premix Ex Taq™ (Tli RNase H Plus 2×), 0.04 μL of each primer (50 μM), and 0.5 μL of the DNA extract, adjusted with sterile distilled water to a total volume of 10 μL. The PCR conditions were as follows: initial denaturation at 95°C for 30 seconds, followed by 30 repeated cycles of 95°C for 3 s and 60°C for 30 s. Samples wherein the amplification of PCR products was confirmed by 30 cycles were deemed positive, while samples wherein the amplification was not confirmed were deemed negative (below the detection limit). The bacterial count per 1 g of feces was calculated by creating a calibration curve using the DNA extracted from B-3 and BB536 raw material with known bacterial counts.

Results

Nonclinical Study

Table 1 shows the formulation disintegrability results, while Table 2 shows the bacterial survivability (live bacterial count) results in the nonclinical study. The disintegration time in solution 1 was 180 minutes or longer (did not disintegrate by 180 minutes) for the acid-resistant formulation, and 16.2±2.3 minutes for the nonacid-resistant formulation. When the test formulations were immersed in solution 1, the outer capsule gradually dissolved, but in the acid-resistant formulation, the powder in the capsule formed a lump and maintained the lump until for 180 min. After transfer to solution 2 following treatment with solution 1, the formulation disintegrated after 10.8±1.3 minutes. Since the nonacid-resistant formulation disintegrated completely in solution 1, it was not subjected to disintegration testing in solution 2. Results following treatment with solution 1 revealed that the live bacterial count of the acid-resistant formulation was 8.2×108 cfu/g, while that of the nonacid-resistant formulation was less than 1.0×105 cfu/g.

biomedres-openaccess-journal-bjstr

Table 1: Disintegration time of samples.

Note: No Experiment.

biomedres-openaccess-journal-bjstr

Table 2: Number of Bifidobacteria after treatment with the 1st fluid.

Note: cfu: Colony Forming Unit

Clinical Study

biomedres-openaccess-journal-bjstr

Table 3: Subject Background.

Note: *BMI: Body Mass Index, n=10.

Table 3 shows the background characteristics of the subjects who participated in the clinical study (n=10). The average age was 39.8±10 years, and the average BMI was 23.2±3.4 kg/m2. All subjects completed the study, and since it was confirmed that there were no issues with the test food intake rate (more than 90%) and compliance, we included the data from all subjects in the analysis.

Culture Method

In a culture experiment using fecal samples collected from the subjects, colony growth was confirmed on all plates. As a result of RT-qPCR using colony-derived DNA, B-3 and BB536 were all negative before the intervention. On the other hand, after the intervention, B-3 was positive in 6 subjects and BB536 was positive in 1 subject (Table 4).

biomedres-openaccess-journal-bjstr

Table 4: Detection of live B-3 and BB536 bacteria of each subject in the fees (culture method).

Note: +: Detect

-: Not detect (Below the detection limit).

PMA Method

biomedres-openaccess-journal-bjstr

Table 5: Number of Bifidobacteria in faces (without PMA treatment).

Note: ND: Not Detect (<1.0×105).

The results of RT-qPCR without PMA treatment are shown in Table 5. Both B-3 and BB536 were negative in feces before intervention. On the other hand, the postintervention fecal samples of 8 subjects tested positive for B-3, while those of 7 subjects tested positive for BB536. The average total cell count per 1 g of feces was 2.2×106 cells/g (n=8) for B-3 and 5.8×106 cells/g (n=7) for BB536. Table 6 shows the results of RT-qPCR performed on fecal samples that underwent PMA treatment. The preintervention fecal samples from all subjects tested negative for both B-3 and BB536. Conversely, the postintervention fecal samples of 6 subjects tested positive for B-3, while that of 1 subject tested positive for BB536. Additionally, the average cell count per 1 g of feces in positive subjects was 6.7×105 cells/g (n=6) for B-3 and 2.6×105 cells/g (n=1) for BB536.

biomedres-openaccess-journal-bjstr

Table 6: Number of Bifidobacteria in faces (without PMA treatment).

Note: ND: Not Detect (<1.0×105).

Discussion

In this study, we used an acid-resistant formulation containing live bifidobacteria to evaluate the acid resistance and bacterial survivability of the formulation through both a nonclinical and clinical approach. The results of the nonclinical investigation indicated that the acid-resistant formulation formed a powderous lump after dissolution of the coating capsule in a strongly acidic environment, protecting the bifidobacteria contained within the acid for more than 180 min. Since it has been reported that the residence time of regular food in the stomach upon ingestion is approximately 2 to 3 h [15], our results suggest that if the acidresistant formulation is ingested along with food, it is very likely to reach the intestinal tract, with the bifidobacteria on the inside protected from gastric acid. Conversely, the disintegration time of the nonacid-resistant formulation was around 16 min; thus, we hypothesized that it would disintegrate in the stomach, and the gastric acid would kill the bifidobacteria when the formulation is ingested along with food. Furthermore, as the powderous lump disintegrated around 11 min after being transferred to solution 2 following treatment with solution 1, we believe that the powderous lump that reaches the intestinal tract would gradually release bifidobacteria in the intestines. Additionally, from the results of the culture experiment using the formulation after treatment with solution 1, it was considered that the released bacteria contained many viable bacteria. The fact that live B-3 and BB536 bacteria were detected in fecal samples after subjects had ingested the test food in the clinical study supports the hypothesis obtained from the nonclinical study; furthermore, no live bacteria were detected in the preintervention fecal samples, supporting the notion that that the live bacteria detected post intervention came from the test food.

In the clinical study, aside culture method, we measured both the total number of B-3, BB536 and the number of live B-3, BB536 using the PMA reagent. Following RT-qPCR conducted using fecal samples not treated with PMA, the average bacterial counts (total number of dead and live bacteria) were 2.2×106 cells/g of feces for B-3 and 5.6×106 cells/g of feces for BB536. The ratio of B-3 and BB536 contained in the test food was 1:2, while the ratio of total B-3 and BB536 in feces was 1:2.5; therefore, we were able to observe a correlation between the ingested and excreted bacterial levels. On the other hand, in the fecal samples treated with PMA indicated that the average viable bacterial count was 6.7×105 cells/g of feces for B-3 and 2.6×105 cells/g of feces for BB536. As PMA treatment renders the DNA of dead bacteria unreactive to PCR, the viable bacterial count decreased to approximately 1/10 of the total bacterial count. Since the detection limit of the RT-qPCR method is approximately 1.0×105–106 copies per gram of feces [16], it is considered that many of the subjects remained below the detection limit, particularly regarding live bacterial detection.

The balance in the feces was higher for BB536 in terms of total bacteria count and for B-3 in terms of viable bacteria count. This suggests that there is a difference in the survival rate of BB536 and B-3 in feces during the period of transportation or storage after excretion. The conventional culture method, as a way to detect live bacteria in feces samples, has several disadvantages such as complexity of procedure, long culture time, presence of unculturable microorganisms and inability to use feces samples stored in freezing conditions, while the PCR method is burdened with the disadvantage of not being able to distinguish between dead and live bacteria. The approach to live bacteria detection using the PMA reagent that was adopted in this study, although not imparting absolute selectivity to live bacteria, produced a high concordance rate between the rate and number of positive results between the culture method and PMA-PCR, which means that one important outcome of this study is that it demonstrated the usefulness of PMA-PCR as a method of detecting live bifidobacteria in feces.

One of the research limitations of this study is that the conditions for the intake of the test foods were varied because the diet during the intervention period was not standardized. Furthermore, in consideration of the burden on the subjects, only one feces sample was taken after the intervention, so there is a possibility that feces with low viable bacteria count was submitted accidentally. Currently, there is no other way to confirm that orally ingested bacteria have reached the intestine alive than to detect viable bacteria in feces. However, there is a risk that this method may underestimate the rate of viable bacteria reaching the intestine, because the viability in the intestine does not always match the viability in the feces. In the future, in addition to the issues of clinical trials, more simple, accurate, and sensitive technologies are expected to be developed for viable bacteria detection methods. This study examined the properties of an acid-resistant formulation containing bifidobacteria and the viability of the bacteria in an acidic environment. The results indicated that the formulation formed a powderous lump under strongly acidic conditions, protecting the bifidobacteria from gastric acid for over 3 h. It was also confirmed that live bifidobacteria derived from the test food were detected in the feces of the subjects when orally ingested the formulation. These results suggest that this formulation is effective in protecting bifidobacteria from acid and delivering them alive to intestinal tract.


For more Articles on: https://biomedres01.blogspot.com/

The Resistance of the Cantilever Bridge by the Use of Dual Resinous Cement

  The Resistance of the Cantilever Bridge by the Use of Dual Resinous Cement Advantages for Dental Bridges with Resin-Fixed Dental Prosthese...